rs2327874 chr6:138109506 G>T
- Sequence
caactgtaagtgactaagttattt[G/T]agacaatgcaatcattcatcctag
- ASB in cell types
- skeletal muscles and myoblasts H929 (plasma cell myeloma) GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| skeletal muscles and myoblasts | 1.42 | -1.43 | 1.33 | |||
| H929 (plasma cell myeloma) | -1.71 | 1.51 | 1.50 | |||
| GM12878 (female B-cells) | 0.51 | 0.56 | 1.35 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Frontal_Cortex_BA9, Brain_Hippocampus, Brain_Hypothalamus, Brain_Spinal_cord_cervical_c-1, Cells_Cultured_fibroblasts, Liver, Nerve_Tibial, Thyroid