rs2328504 chr6:143517154 G>A
- Sequence
acatcagagaatggagctgggggg[G/A]aaaaaaagattcaaacacaaagaa
- ASB in cell types
- K562 (myelogenous leukemia) GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.46 | 0.33 | 1.27 | |||
| GM12878 (female B-cells) | -1.52 | 1.54 | 1.50 |
Items per page:
1 – 2 of 2