rs234024 chr3:172623401 T>C
- Sequence
ccgcagtgtatgggatggcgaacg[T/C]cgttgactttcaaggcgccctcta
- ASB in cell types
- foreskin keratinocyte HEK293 (embryonic kidney) CD34+ hematopoietic stem cells
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | n/a | 0.68 | 2.17 | |||
| HEK293 (embryonic kidney) | 0.13 | 0.78 | 1.51 | |||
| CD34+ hematopoietic stem cells | -1.75 | 1.97 | 2.00 |
Items per page:
1 – 3 of 3