rs2340810 chr2:44309407 T>C
- Sequence
tgtatgagatcttactccttctta[T/C]gactgaataacattccatggtacc
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.16 | 0.65 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), body mass index (bmi), diabetic retinopathy in type 2 diabetes mellitus, hdl cholesterol, height, lp-pla2 activity
GTEx eQTL Adrenal_Gland, Artery_Tibial, Brain_Cerebellum, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Muscle_Skeletal, Thyroid