rs234106 chr1:184972888 A>G
- Sequence
tagtgtacttggccatgcgtccac[A/G]ttaggtgctcctaagctttccagt
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney) GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.63 | 0.93 | 2.84 | |||
| HEK293 (embryonic kidney) | -0.18 | 0.53 | 2.00 | |||
| GM12878 (female B-cells) | 0.65 | 0.24 | 1.31 |
Items per page:
1 – 3 of 3