rs234460 chr14:97383625 A>G
- Sequence
agggaaattttgattccaatgacc[A/G]agaactaataatattcactggcat
- ASB in cell types
- GM12878 (female B-cells)
- ASB for transcription factors
- IKZF2_HUMAN IKZF1_HUMAN ENL_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| IKZF2_HUMAN | 1.58 | -1.12 | 1.33 | n/a | n/a | |||
| IKZF1_HUMAN | 1.59 | -0.25 | 1.33 | n/a | No Hit | |||
| ENL_HUMAN | 1.75 | -1.78 | 1.33 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP alzheimers disease, college completion, late onset alzheimers disease, ldl cholesterol, longstanding arthritis, proximal colon cancer, total cholesterol, triglycerides, years of education