rs234914 chr6:2209446 T>C
- Sequence
tgcagggggagtagtcccgcacaa[T/C]aggcaggtgttagccaagatgcct
- ASB in cell types
- K562 (myelogenous leukemia) foreskin keratinocyte 22RV1 (prostate carcinoma) A549 (lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.84 | -0.62 | 2.95 | |||
| foreskin keratinocyte | 0.56 | n/a | 2.50 | |||
| 22RV1 (prostate carcinoma) | 0.81 | -0.79 | 1.00 | |||
| A549 (lung carcinoma) | 0.49 | 0.30 | 1.15 | |||
| H1 (embryonic stem cells) | 0.84 | 0.42 | 1.44 |
Items per page:
1 – 5 of 7