rs235000 chr20:49595985 A>T
- Sequence
agcaggtgctcagtagacccttgg[A/T]gactgcgtgggtgctggagtagaa
- ASB in cell types
- HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 0.09 | 0.57 | 1.24 |
Items per page:
1 – 1 of 1