rs235030 chr20:49631715 C>T
- Sequence
caaggctgctgccttctcttactc[C/T]atgcttcctgttctcaatccccca
- ASB in cell types
- GM12878 (female B-cells) K562 (myelogenous leukemia) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | -0.01 | 0.86 | 1.41 | |||
| K562 (myelogenous leukemia) | 0.91 | -0.23 | 2.00 | |||
| HEK293 (embryonic kidney) | 0.56 | -0.26 | 2.04 |
Items per page:
1 – 3 of 3