rs235284 chr21:44865750 C>A
- Sequence
cacagaaggctgtgtttcagatct[C/A]tctgtgagaggaagtgtgccctgt
- ASB in cell types
- monocyte-derived dendritic cells periferal blood macrophages CD34+ hematopoietic stem cells-derived proerythroblasts MDA-MB-453 (breast adenocarcinoma)
- ASB for transcription factors
- SPI1_HUMAN GATA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 1.67 | 0.24 | 2.22 | n/a | No Hit | |||
| GATA1_HUMAN | 1.47 | -1.05 | 1.50 | 3.68 | Discordant |
Items per page:
1 – 2 of 2
Motif analysis
