rs235877 chr1:171645165 T>C
- Sequence
gttttcctgtcctgcgtccatagg[T/C]ggtatgactgtgaggacatttgtt
- ASB in cell types
- K562 (myelogenous leukemia) PC3 (prostate carcinoma) HeLa S3 (cervical adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.63 | 1.23 | 2.85 | |||
| PC3 (prostate carcinoma) | 1.59 | -1.36 | 1.50 | |||
| HeLa S3 (cervical adenocarcinoma) | 1.13 | 0.84 | 1.33 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Esophagus_Mucosa, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid