rs2358972 chr17:1487886 A>G
- Sequence
agtgagccgagattgtgccactgc[A/G]ctccagcctgggcgacagagcgaa
- ASB in cell types
- GM12878 (female B-cells) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 1.78 | -1.68 | 1.33 | |||
| HEK293 (embryonic kidney) | 0.67 | 0.56 | 1.71 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Brain_Cerebellum, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Muscle_Skeletal, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Spleen