rs235924 chr1:213983517 T>C
- Sequence
ccactgcgcccccgcgtgcaaagg[T/C]gtccccttcacactcacaccctca
- ASB in cell types
- HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.53 | -0.04 | 2.03 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adrenal_Gland, Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hippocampus, Brain_Putamen_basal_ganglia, Colon_Transverse, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Pancreas, Pituitary, Prostate, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Testis, Thyroid