rs236971 chr6:16586445 T>C
- Sequence
aactcagttaagacatgatgtcag[T/C]gatggccaaggtcatcacgaacat
- ASB in cell types
- GM12878 (female B-cells)
- ASB for transcription factors
- IKZF1_HUMAN IKZF2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| IKZF1_HUMAN | -0.43 | 1.71 | 1.33 | n/a | No Hit | |||
| IKZF2_HUMAN | 0.17 | 1.74 | 1.33 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), asthma, height, primary rhegmatogenous retinal detachment, tetrology of fallot