rs2374299 chr7:151819224 A>T
- Sequence
gctgcatctgctgttagctagacc[A/T]gtcctgccggtcctaacacctctg
- ASB in cell types
- PC3 (prostate carcinoma)
- ASB for transcription factors
- GRHL2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GRHL2_HUMAN | 1.27 | 0.27 | 1.50 | 0.94 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP diastolic blood pressure (dbp), hdl cholesterol, ldl cholesterol, systolic blood pressure (sbp), total cholesterol