rs238132 chr18:3450457 C>A
- Sequence
ccgctcctggcccctccagacccc[C/A]gccttgcctcgcgctgggagggga
- ASB in cell types
- HEK293 (embryonic kidney)
- ASB for transcription factors
- GLIS2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GLIS2_HUMAN | 2.57 | n/a | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1