rs2384656 chr2:27609188 A>G
- Sequence
acttatgtcttttttggtctaaaa[A/G]ttagtccagagtggtaggtgtgca
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.20 | 1.72 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, adiponectin levels, cystatin c in serum, fasting blood glucose, hdl cholesterol, homa-ir, plasma palmitoleic acid, plasma protein-c levels, serum creatinine, serum urate, total cholesterol, total cholesterol change with statins, triglycerides, triglycerides change with statins, waist hip ratio
GTEx eQTL Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid, Whole_Blood