rs239222 chr6:100664941 T>A
- Sequence
gtttggttttaggttaagtctgct[T/A]tctgtgggctccctgcattgaaat
- ASB in cell types
- GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 0.58 | 0.14 | 1.32 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP cystatin c in serum, diastolic blood pressure (dbp), height, ldl cholesterol, mitral annular calcium, obesity with early age of onset (age >2), refractive error, rheumatoid arthritis, total cholesterol
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Brain_Anterior_cingulate_cortex_BA24, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Lung