rs2400695 chr12:80187524 A>G
- Sequence
tggatgccatctcctgattacaat[A/G]tgaatattctggggttgttaattt
- ASB in cell types
- HEK293 (embryonic kidney)
- ASB for transcription factors
- ZN366_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZN366_HUMAN | n/a | 2.64 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP autism, body mass index (bmi) (within family tests), chronic kidney disease, diastolic blood pressure (dbp), hip bone mineral density (bmd), ldl cholesterol, parkinsons disease, serum creatinine, spine bone mineral density (bmd)