rs2402976 chr7:129702564 G>A
- Sequence
actacaaataattcccaatatagg[G/A]caaatgaatcactttgctttagct
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.13 | 0.67 | 1.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP asthma, birth weight, chronic kidney disease, diastolic blood pressure (dbp), major depressive disorder (narrow definition), major depressive disorder (narrow definition) (females), recurrent early onset major depressive disorder, recurrent early onset major depressive disorder (females), rheumatoid arthritis, serum creatinine
GTEx eQTL Artery_Aorta, Artery_Coronary, Cells_EBV-transformed_lymphocytes, Nerve_Tibial, Testis, Thyroid