rs240378 chr6:75286732 A>T
- Sequence
gtatatatggtcattttaccttca[A/T]ttttttgtttttgttctagtgatc
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- RING2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RING2_HUMAN | 1.95 | -2.10 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Nerve_Tibial, Spleen, Whole_Blood