rs241409 chr6:32894143 A>G
- Sequence
aaagctcgagctgttacccctccc[A/G]acttcttccgccttccgccttccc
- ASB in cell types
- GM12878 (female B-cells)
- ASB for transcription factors
- FOXK2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXK2_HUMAN | 1.81 | -1.84 | 1.33 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP ldl cholesterol change with statins, parkinsons disease, rheumatoid arthritis, rheumatoid arthritis (acpa-positive), stabilized warfarin dose, total cholesterol change with statins, triglycerides, type 1 diabetes
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Whole_Blood