rs2423128 chr20:5657901 A>C
- Sequence
ttgggatgcagaattcagcatgca[A/C]ccacatgcaatttacaagcacagg
- ASB in cell types
- A549 (lung carcinoma) GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | -0.31 | 0.93 | 2.92 | |||
| GM12878 (female B-cells) | n/a | 1.43 | 1.33 |
Items per page:
1 – 2 of 2