rs2425460 chr20:40966320 G>T
- Sequence
ctgcacccaggcttggccttgagg[G/T]tcctctgcttgtctcaactctgca
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.13 | 0.66 | 1.34 | -1.88 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP arthritis including non-rheumatoid, biploar disorder (bipolar schizoaffective disorder), body mass index (bmi), ldl cholesterol, rheumatoid arthritis