rs242805 chr20:60063897 C>T
- Sequence
tgggatggatggtcattggtgtca[C/T]ggactgtggtgtagacattgtctc
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 0.88 | -0.72 | 3.95 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP hypertension (early onset hypertension), sporadic creutzfeldt-jakob disease, total cholesterol change with statins, triglycerides change with statins
GTEx eQTL Adipose_Visceral_Omentum, Brain_Cerebellar_Hemisphere, Brain_Hypothalamus, Brain_Putamen_basal_ganglia, Esophagus_Mucosa, Heart_Atrial_Appendage, Lung, Muscle_Skeletal, Nerve_Tibial, Prostate, Spleen, Thyroid, Whole_Blood