rs2429399 chr17:62634812 T>C
- Sequence
tttaaagatggagttgctctggtt[T/C]gaacacctctgatacaactttttt
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | -0.67 | 1.14 | 2.53 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Brain_Cerebellar_Hemisphere, Lung, Prostate, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid