rs243549 chr7:148698580 A>C
- Sequence
cgcgagcgggggcctcggccgcgg[A/C]aggggcgcccccggggccgccggc
- ASB in cell types
- HEK293 (embryonic kidney) HEK293T (embryonic kidney) LNCaP C4-2B (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 1.32 | -0.43 | 1.96 | |||
| HEK293T (embryonic kidney) | 1.31 | -0.49 | 1.91 | |||
| LNCaP C4-2B (prostate carcinoma) | -0.77 | 1.43 | 1.50 |
Items per page:
1 – 3 of 3