rs243550 chr7:148698392 G>C
- Sequence
ctggtggtgtccccgacccaagca[G/C]ctcagccccgctcgcgaggtccga
- ASB in cell types
- HEK293 (embryonic kidney) HEK293T (embryonic kidney) GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.99 | -0.21 | 1.95 | |||
| HEK293T (embryonic kidney) | 1.09 | -0.27 | 1.92 | |||
| GM12878 (female B-cells) | 0.69 | 0.45 | 1.28 |
Items per page:
1 – 3 of 3