rs244128 chr20:44540989 G>C
- Sequence
ggcctcgtcagtattagttggttg[G/C]agaggggaaggaagttaggaccag
- ASB in cell types
- K562 (myelogenous leukemia) periferal blood macrophages
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.27 | 1.03 | 2.00 | |||
| periferal blood macrophages | -1.43 | 1.89 | 2.00 |
Items per page:
1 – 2 of 2