rs2444961 chr15:33133159 G>A
- Sequence
caacagttaactcacaaggaagag[G/A]ggattatgcaactgagttcatggg
- ASB in cell types
- foreskin keratinocyte macrophages
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 1.13 | -0.58 | 2.11 | |||
| macrophages | 1.65 | -0.60 | 2.00 |
Items per page:
1 – 2 of 2