rs245023 chr7:112130118 G>A
- Sequence
aatttgagccgagtttgaatgttg[G/A]gtaagaggtcacctggcaaacctg
- ASB in cell types
- HepG2 (hepatoblastoma) MCF10A (breast epithelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 0.71 | 0.25 | 1.31 | |||
| MCF10A (breast epithelial cells) | n/a | 1.86 | 1.50 |
Items per page:
1 – 2 of 2