rs2450333 chr5:177472545 G>A
- Sequence
cagctcagcgggagacaacagctg[G/A]ggggcggggtgaggggcggcccag
- ASB in cell types
- K562 (myelogenous leukemia) neural cell
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.83 | -0.31 | 2.01 | |||
| neural cell | 0.24 | 1.04 | 1.00 |
Items per page:
1 – 2 of 2