rs2451594 chr6:76351522 G>A
- Sequence
tcagaactgctggtgtaaaacatg[G/A]gattggtaactcacctttgtatgt
- ASB in cell types
- MCF10A (breast epithelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF10A (breast epithelial cells) | 1.85 | -1.65 | 1.33 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP fasting blood glucose, mitral annular calcium, salmonella-induced pyroptosis, suicide attempts in bipolar disorder, suicide attempts in bipolar disorder (females)