rs2459178 chr21:10432425 A>G
- Sequence
ccccaggctggagtgcagtggcac[A/G]atcttggctcactgcaacctctgc
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) HEK293T (embryonic kidney) HepG2 (hepatoblastoma) LNCaP C4-2B (prostate carcinoma)
- ASB for transcription factors
- ZFX_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZFX_HUMAN | -2.06 | 2.46 | 2.35 | n/a | No Hit |
Items per page:
1 – 1 of 1