rs245973 chr7:29255359 A>T
- Sequence
ggcagggctcctgtggcctggccc[A/T]tgtgacccccagccagtcctaaat
- ASB in cell types
- 501Mel-Cl8 (melanoma)
- ASB for transcription factors
- MITF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MITF_HUMAN | 1.97 | -1.62 | 1.50 | -3.25 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
