rs245974 chr7:29256240 T>C
- Sequence
ttttgggtgaatgaatgagacata[T/C]gccctcaagccccagataacttct
- ASB in cell types
- HEK293 (embryonic kidney) K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.61 | 0.42 | 1.48 | |||
| K562 (myelogenous leukemia) | 1.32 | -1.01 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP birth weight, microalbuminuria, systolic blood pressure (sbp), triglycerides change with statins