rs246175 chr16:14286291 G>A
- Sequence
ctcaaagggtcccctgcagatcat[G/A]gcctcagggaagccccaacaccct
- ASB in cell types
- HEK293 (embryonic kidney) K562 (myelogenous leukemia) GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 1.13 | -0.12 | 1.94 | |||
| K562 (myelogenous leukemia) | -0.03 | 0.75 | 2.01 | |||
| GM12878 (female B-cells) | 0.76 | 0.36 | 1.25 |
Items per page:
1 – 3 of 3