rs246829 chr7:12942814 T>C
- Sequence
tcaacaatagcttgtttggatttc[T/C]tcagctggattttttgctttgcca
- ASB in cell types
- VCaP (prostate carcinoma) ZR-75-1 (invasive ductal carcinoma) HEK293 (embryonic kidney) HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| VCaP (prostate carcinoma) | 1.23 | -0.19 | 1.82 | |||
| ZR-75-1 (invasive ductal carcinoma) | 1.73 | -0.61 | 2.00 | |||
| HEK293 (embryonic kidney) | 0.32 | 0.61 | 1.48 | |||
| HepG2 (hepatoblastoma) | 0.60 | 0.38 | 1.31 | |||
| CWR22 (prostate carcinoma) | -0.19 | 1.54 | 2.00 |
Items per page:
1 – 5 of 5