rs2472801 chr6:14765876 T>C
- Sequence
cctgaatcagaaaagtataaagag[T/C]ggaaaatatttaatattttgaact
- ASB in cell types
- monocyte-derived macrophages
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | -1.36 | 1.52 | 2.17 | n/a | No Hit |
Items per page:
1 – 1 of 1