rs2473332 chr1:22042624 C>T
- Sequence
ctccacagcagctgggactacagg[C/T]gcacgctgccacgccctgctaatt
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- EP400_HUMAN IKZF1_HUMAN ENL_HUMAN SMCA4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| EP400_HUMAN | 2.15 | -1.84 | 1.33 | n/a | n/a | |||
| IKZF1_HUMAN | 1.83 | n/a | 1.33 | n/a | No Hit | |||
| ENL_HUMAN | 1.35 | -1.09 | 1.33 | n/a | n/a | |||
| SMCA4_HUMAN | 1.33 | -0.72 | 1.33 | n/a | n/a |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Anterior_cingulate_cortex_BA24, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Nucleus_accumbens_basal_ganglia, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Ovary, Pancreas, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood