rs2477695 chr1:2468175 A>G
- Sequence
cccagcccctgatcgaggttggca[A/G]aggtggccctgagctgcagtcagc
- ASB in cell types
- HeLa S3 (cervical adenocarcinoma) PFSK1 (primitive neuroectodermal tumor) SK-N-SH (neuroblastoma)
- ASB for transcription factors
- REST_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| REST_HUMAN | 2.04 | -0.05 | 1.77 | n/a | No Hit |
Items per page:
1 – 1 of 1