rs248460 chr5:151224174 C>G
- Sequence
gaagagcggggcctcagtgtagcc[C/G]gcagggccagcggcgccgccacca
- ASB in cell types
- foreskin keratinocyte cranial neural crest cells GM12878 (female B-cells) Peyer's patch
- ASB for transcription factors
- AP2A_HUMAN STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| AP2A_HUMAN | 2.43 | n/a | 2.00 | -4.48 | Concordant | |||
| STAT1_HUMAN | 0.97 | -0.90 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
