rs2486006 chr1:43980962 A>G
- Sequence
gcctgggtgtctgtttggaggtaa[A/G]ttcttgagtctgtgagtgtgaaag
- ASB in cell types
- HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.86 | -0.13 | 1.99 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Colon_Transverse, Esophagus_Muscularis, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Thyroid, Whole_Blood