rs249477 chr5:68022086 T>C
- Sequence
tttaaataagtgtaatagaatatt[T/C]gctagcatttgcttttcctgaatt
- ASB in cell types
- liver
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| liver | 1.00 | -0.41 | 1.33 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP irritible bowel syndrome, ldl cholesterol, longstanding arthritis, microalbuminuria, partial epilepsy, tetrology of fallot, total cholesterol