rs2501789 chr1:17304527 C>A
- Sequence
agggtttctggcctggatcctgag[C/A]cgctcaccatgtataagagagttc
- ASB in cell types
- cranial neural crest cells
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| cranial neural crest cells | n/a | 1.76 | 2.00 |
Items per page:
1 – 1 of 1