rs2518804 chr22:18987991 A>C
- Sequence
cctgcgggcatcccaggaggatga[A/C]cacgccatactccctgcgcactga
- ASB in cell types
- liver
- ASB for transcription factors
- RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RAD21_HUMAN | -1.48 | 1.85 | 1.33 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP fasting insulin, homa-b, homa-ir, ldl cholesterol change with statins, total cholesterol, total cholesterol change with statins, triglycerides change with statins
GTEx eQTL Brain_Amygdala, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Putamen_basal_ganglia, Pancreas