rs252803 chr5:107428231 A>G
- Sequence
agtgcatctcgattttgatgcagc[A/G]tcttttccatactgagaaaacaac
- ASB in cell types
- GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 0.36 | 1.06 | 1.30 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), college completion, diabetic retinopathy in type 2 diabetes mellitus, recurrent early onset major depressive disorder, recurrent early onset major depressive disorder (females), recurrent early onset major depressive disorder (males)