rs252816 chr5:107388710 G>A
- Sequence
atgacaaaaattacagaaacgagc[G/A]tcgcatactttcctccctatgtgt
- ASB in cell types
- GM12878 (female B-cells) A549 (lung carcinoma) T47D (invasive ductal carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 0.36 | 0.81 | 1.29 | |||
| A549 (lung carcinoma) | 0.85 | -0.29 | 2.08 | |||
| T47D (invasive ductal carcinoma) | -0.19 | 0.71 | 2.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, advanced age-related macular degeneration (geographic atrophy), college completion