rs252818 chr5:107389990 C>T
- Sequence
atttgtgaacaaagaatattagca[C/T]acaatgtgatatgtgagtacacaa
- ASB in cell types
- GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 0.21 | 0.64 | 1.29 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), barnes akathisia rating scale, college completion, maternal transmission distortion, plasma brain natriuretic peptide (bnp), recurrent early onset major depressive disorder, recurrent early onset major depressive disorder (females), recurrent early onset major depressive disorder (males), salmonella-induced pyroptosis, transmission distortion