rs253438 chr5:142421651 A>G
- Sequence
cctgtgtctgtggctacctggtca[A/G]cagcctggctttatccctagataa
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.62 | -0.28 | 1.98 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, asthma, bipolar disorder, cystatin c in serum, diastolic blood pressure (dbp), microalbuminuria, primary rhegmatogenous retinal detachment, schizophrenia, systolic blood pressure (sbp), urinary albumin-to-creatinine ratio
GTEx eQTL Brain_Cerebellum, Cells_Cultured_fibroblasts, Lung, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid